#### RestrictionEnzyBase ####

I-SceVI

Restriction Enzyme Name	I-SceVI
Methyltranferases
Recognition Sequence	GTTATTTAATGTTTTAGTAGTTGG (-13/-3)
Type	Homing
Subtype	-
Prototype	I-SceVI
Organism	Saccharomyces cerevisiae
Temperature	30 °
Molecular weight	96073
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter
Isochizomers	-
Synonyms	aI1 endo
Suppliers	-
Cloned/sequenced	cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes	yes
Star Activity
Single stranded cleavages
Orphan methyltransferases