#### RestrictionEnzyBase ####

I-HmuII

Restriction Enzyme Name	I-HmuII
Methyltranferases
Recognition Sequence	AGTAATGAGCCTAACGCTCAACAA (?/39)
Type	Homing
Subtype	-
Prototype	I-HmuII
Organism	Bacillus subtilis bacteriophage SP82
Temperature	30 °
Molecular weight	21298
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter	yes
Isochizomers	-
Synonyms	-
Suppliers	-
Cloned/sequenced	cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes	yes
Star Activity
Single stranded cleavages
Orphan methyltransferases