#### RestrictionEnzyBase ####

I-HmuI

Restriction Enzyme Name	I-HmuI
Methyltranferases
Recognition Sequence	AGTAATGAGCCTAACGCTCAGCAA (?/-8)
Type	Homing
Subtype	-
Prototype	I-HmuI
Organism	Bacillus subtilis bacteriophage SPO1
Temperature	30 °
Molecular weight	19764
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter
Isochizomers	yes
Synonyms	-
Suppliers	-
Cloned/sequenced	cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes	yes
Star Activity
Single stranded cleavages
Orphan methyltransferases