The Restriction EnzyBase Project
Bioinformatics Research Lab.
IBI Biosolutions Pvt. Ltd., India




IBI Biosolutions Pvt. Ltd.
www.ibibiosolutions.com

 

   

I-CpaI

 
Restriction Enzyme Name I-CpaI
Methyltranferases
Recognition Sequence CGATCCTAAGGTAGCGAAATTCA (-5/-9)
Type Homing
Subtype -
Prototype I-CpaI
Organism Chlamydomonas pallidostigmatica
Temperature 26 °
Molecular weight 17928
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter
Isochizomers -
Synonyms -
Suppliers -
Cloned/sequenced cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes yes
Star Activity
Single stranded cleavages
Orphan methyltransferases
 
 
© 2007 www.ibibiosolutions.com. All rights reserved