The Restriction EnzyBase Project
Bioinformatics Research Lab.
IBI Biosolutions Pvt. Ltd., India




IBI Biosolutions Pvt. Ltd.
www.ibibiosolutions.com

 

   

I-AniI

 
Restriction Enzyme Name I-AniI
Methyltranferases
Recognition Sequence TTGAGGAGGTTTCTCTGTAAATAA (-11/-15)
Type Homing
Subtype -
Prototype I-AniI
Organism Aspergillus nidulans
Temperature 30 °
Molecular weight 35416
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter
Isochizomers -
Synonyms -
Suppliers -
Cloned/sequenced cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes yes
Star Activity
Single stranded cleavages
Orphan methyltransferases
 
 
© 2007 www.ibibiosolutions.com. All rights reserved