#### RestrictionEnzyBase ####

F-TevI

Restriction Enzyme Name	F-TevI
Methyltranferases
Recognition Sequence	GAAACACAAGAAATGTTTAGTAAA (-13/14)
Type	Homing
Subtype	-
Prototype	F-TevI
Organism	Bacteriophage T4
Temperature	37 °
Molecular weight	25338
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter	yes
Isochizomers	-
Synonyms	N-TevI,SegA
Suppliers	-
Cloned/sequenced	cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes	yes
Star Activity
Single stranded cleavages
Orphan methyltransferases