#### RestrictionEnzyBase ####

F-SceI

Restriction Enzyme Name	F-SceI
Methyltranferases
Recognition Sequence	GATGCTGTAGGCATAGGCTTGGTT (-12/-16)
Type	Homing
Subtype	-
Prototype	F-SceI
Organism	Saccharomyces cerevisiae
Temperature	30 °
Molecular weight	57788
Blunt End
3' Sticky End
5' Sticky End
Length of Overhang
Outside Cutter
Isochizomers	-
Synonyms	Endo.SceI
Suppliers	-
Cloned/sequenced	cloned and sequenced
Specificity Subunit
Nicking Enzymes
Methyl directed
Homing enzymes	yes
Star Activity
Single stranded cleavages
Orphan methyltransferases