Home | About us | Contact us | Our Team | Help
 
p53 Database
p53 Structures

Detail Information of ie54h04.y1 EST:

dbEST Id 9949908
Organ Pancreas
sequencing
Tissue type Islets of Langerhans
EST name ie54h04.y1
GenBank Acc BI962808
GenBank gi 16337213
Clone Id IMAGE:5670775 (5')
DNA type cDNA
PolyA Tail Unknown
Sequence CGAGAAGCTGCGCAAACTCAGCGAGATCAACAAGTTGCTGGCGCATCGGCCATGGCTCAT CACCAAGGAACACATCCAGGCCTTGCTGAAGACCGGCGAGCACACTTGGTCCCTGGCCGA GCTCATTCAGGCTCTGGTCCTGCTCACCCACTGCCACTCGCTCTCCTCCTTCGTGTTTGG CTGTGGCATCCTCCCTGAGGGGGATGCAGATGGCAGCCCTGCCCCCGCTAACCGGCTAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
vector pSPORTl
Rsite1 Not 1
Rsite2 Sal 1
Description Starting library constructed using SuperScript Plasmid Library kit (Life Technologies). cDNA made by oligo-dT priming. Size-selected by column fractionation; average insert size 1.08 kb. Library was amplified once on solid support and plasmid DNA from library was prepared. The library DNA was normalized by method #4 from Bonaldo, Lennon , and Soares 1996 Genome Research 6:791-806; 0.5 microgram single-stranded library plasmid DNA was mixed with 5 micrograms PCR product representing library inserts and hybridized to an Ecot of 20. Single-stranded (unhybridized) plasmids were isolated by hydroxyapatite chromatography and used to make this library.
Putative ID Assigned by submitter TR:Q9UPD5 Q9UPD5 P53 REGULATED PA26-T3 NUCLEAR PROTEIN. [1] ;
Lib Name Melton Normalized Human Islet 4 N4-HIS 1
Organism Homo sapiens