Home | About us | Contact us | Our Team | Help
 
p53 Database
p53 Structures

Detail Information of 7f82d12.x1 EST:

dbEST Id 6185991
Organ prostate
sequencing -40UP from Gibco
Tissue type
EST name 7f82d12.x1
GenBank Acc BE858012
GenBank gi 10372611
Clone Id IMAGE:3303479 (3')
DNA type cDNA
PolyA Tail Unknown
Sequence TGGTGGCCAACGACTGGTGGATGGGTGGCTGAAACCAGCGCACATGCTCCACAGTGGAAC TGTCTGGCTCCACGGACTTCATGTATTTGTTCAGGAAGGCCAAAAC
vector pT7T3D-PacI
Rsite1
Rsite2
Description Plasmid DNA from the normalized library NCI_CGAP_Pr22 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 985608-986759, 1101192-1101959, and 1217928-1220615). Subtraction by Bento Soares and M. Fatima Bonaldo.
Putative ID Assigned by submitter TR:Q9UN29 Q9UN29 P53 INDUCIBLE PROTEIN.
Lib Name NCI_CGAP_Pr28
Organism Homo sapiens